Antiproliferative Potential and Immunological Safety of Filopaludina bengalensis Extracts: Morphological and Biochemical Insights
Background: Mollusc-derived compounds are gaining growing attention as potential pharmaceutical agents and functional food supplements. This study investigated the nutraceutical potential of the freshwater mollusc Filopaludina bengalensis, which is widely distributed in West Bengal, India. The research encompassed species authentication and morphological characterization, along with an evaluation of its anti-inflammatory and anticancer activities, to determine its suitability as a natural source of nutraceutical compounds. Materials and Methods: Filopaludina bengalensis specimens were collected from freshwater habitats and identified using mitochondrial cytochrome c oxidase subunit 1 (COI) gene barcoding for molecular authentication. Morphometric measurements, including shell length and weight, were recorded. The flesh and extrapallial fluid were processed to obtain molluscan mass (FBM) and fluid (FBF) extracts. Proximate composition (moisture, protein, carbohydrate, lipid, and minerals) was analyzed. The cytotoxic activity of both extracts was evaluated in breast cancer cell lines (MCF-7 and MDA-MB-231) using the MTT assay. Anti-inflammatory activity was assessed by measuring nitric oxide inhibition in LPS-stimulated RAW264.7 macrophages, while oxidative stress and immune toxicity were evaluated through reactive oxygen species and nitrite production assays. Results: Molecular analysis confirmed the identity of F. bengalensis, validating the reliability of COI barcoding for species-level identification and phylogenetic analysis of freshwater molluscs. The mollusc exhibited an average length of 3.02 cm and weight of 5.57 g, yielding 0.5–1.0 ml of extrapallial fluid. Proximate composition analysis revealed high moisture (68.9%) and protein (50.4%) contents, moderate carbohydrates (33.8%), low lipids (4.3%), and notable mineral levels. Both FBM and FBF extracts showed dose-dependent cytotoxicity against MCF-7 and MDA-MB-231 cell lines, with FBF displaying superior potency (IC50 = 19 µg/ml and 49 µg/ml, respectively) compared to FBM (IC50 = 70.3 µg/ml and 142 µg/ml). In LPS-stimulated macrophages, both extracts significantly inhibited nitrite production, with FBF (IC50 = 49.56 µg/ml) showing stronger anti-inflammatory activity than FBM (IC50 = 77.52 µg/ml). Neither extracts induced nitric oxide or reactive oxygen species production in unstimulated macrophages, indicating low immune toxicity. Conclusion: The findings demonstrate that Filopaludina bengalensis possesses high nutritional value and exhibits selective anticancer and anti-inflammatory activities, particularly within its extrapallial fluid extract. The favourable safety profile and bioactivity of these extracts suggest their potential as natural nutraceutical candidates. Further studies are needed to isolate and characterize the active compounds and elucidate their mechanisms of action for therapeutic development.
Introduction
Nutraceuticals, derived from plant or animal sources, including functional foods, fortified foods, and dietary supplements, offer health benefits beyond basic nutrition, including lipid-lowering, antioxidant, anticancer, anti-inflammatory, and immunomodulatory effects. Ongoing research focuses on their mechanisms, safety, and clinical efficacy, positioning nutraceuticals as valuable tools for future preventive and therapeutic strategies [1, 2]. While not replacements for pharmaceuticals, they provide cost-effective alternatives that closely mimic physiological biomolecules. Mollusc-derived compounds are increasingly recognized as promising pharmaceuticals and functional food supplements with ecologically vital marine and freshwater species such as oysters, clams, mussels, molluscs and squids providing food, pearls, shells, and bioactive compounds with significant therapeutic potential [3, 4]. Freshwater molluscs, particularly gastropods, are abundant across South and Southeast Asia, inhabiting rivers, lakes, ponds, and paddy fields. Characterized by robust, globular–conical shells and thick opercula, they are widely used in traditional remedies, including treatments for respiratory, cardiac, nervous, and hepatic disorders [5, 6]. Nutritionally, these species provide high-quality protein, essential amino acids, omega-3 fatty acids (EPA, DHA), bioavailable minerals (Ca, Fe, Zn, Se, Mg), and vitamins A, B12, and D. In India, states such as West Bengal, Jharkhand, Bihar, Maharashtra, and regions of the northeast utilize gastropods to support immunity, purify blood, prevent conjunctivitis, and as nutritional supplements [7]. Despite the recognized promise of mollusc-derived bioactive potentials, many widely consumed freshwater gastropods remain insufficiently characterized, underscoring the need to investigate species that combine high nutritional value with the potential to serve as sustainable sources of new therapeutic agents.
The abundance of molluscs in West Bengal’s freshwater and marine ecosystems positions them as promising sources for drug discovery and large-scale production. Snails such as Achatina, Bellamya, Lamellidens, and Pila are increasingly valued as nutraceuticals, though their medico-food potential remains underexplored. Lissachatina fulica slime extracts exhibit anti-inflammatory activity, while Bellamya bengalensis demonstrates CNS-depressant, anti-inflammatory, and analgesic effects [8, 9]. Filopaludina bengalensis (currently the approved name of Bellamya bengalensis) provides protein-rich meat and calcium-rich shells, with ethnomedicinal and biomedical evidence highlighting its immunomodulatory and anti-inflammatory potentials. Lipid extracts inhibit NF-κB and ROS pathways, reducing edema, myeloperoxidase activity, nitric oxide as well as cytokine levels, while flesh extracts protect against oxidative stress, mitochondrial damage, and DNA fragmentation [10, 11]. Protein hydrolysates exhibit antioxidative and antihypertensive activities, whereas tissue extracts demonstrate hepatoprotective and anti-arthritic properties [12-14]. Furthermore, secretion extracts of B. bengalensis f. annandalei show potent antineoplastic activity, inducing cytotoxicity, apoptosis, and antiproliferative effects in human leukemia and hepatocellular carcinoma cell lines [15, 16].
Molluscs, due to their integrated nutritional and pharmacological potentials, are increasingly recognized as sustainable functional foods and reservoirs of novel therapeutic agents. Their species diversity and complex chemical nature confer notable anti-inflammatory and immunomodulatory activities, positioning them to address global nutritional needs while offering innovative therapeutic avenues. The association of chronic inflammation, immune dysregulation, and cancer motivated the researchers to explore the freshwater mollusc Filopaludina bengalensis, characterizing its physicochemical properties and evaluating its antiproliferative potential and immunological safety for prospective therapeutic applications.
Materials and Methods
<italic id="italic-c8206a17c7a185b3bbb1d579288b8da3">Collection & Identification<italic id="italic-99f47aeb346df3112ba51d0fada666a9"/></italic>
Freshwater molluscs were collected from ponds in Paschim Midnapore, West Bengal, during the pre-monsoon period (February–May) and authenticated by the Zoological Survey of India, Kolkata, as Filopaludina bengalensis Lamarck (Viviparidae). Both the footpad (body mass) and extrapallial fluid were collected and extracted from the molluscs for subsequent experimental analyses.
Molluscs were thoroughly washed with distilled water. Extrapallial fluid was carefully aspirated from live specimens using a sterile syringe beneath the shell margin and mantle, avoiding disruption of the mantle or shell. The fluid was centrifuged at 3500 rpm for 15 min at 4 °C to remove debris, and the clear supernatant was lyophilized (designated FBF). The remaining body mass was eviscerated, footpads collected, homogenized in phosphate buffer (1:10), and centrifuged under cold conditions to remove debris. The resulting supernatant was lyophilized (denoted FBM). Lyophilized powders of both fluid and mass extracts were stored at –20 °C until further use.
Molluscan samples were authenticated using DNA barcoding, a precise method for species identification based on sequence variation in a standardized DNA region [17]. Genomic DNA was extracted from both tissue and fluid, and a 642 bp fragment of the mitochondrial cytochrome c oxidase subunit 1 (COI) gene was amplified via PCR using primers 5′–GGTCAACAAATCATAAAGATATTGG–3′ (forward) and 5′–TAAACTTCAGGGTGACCAAAAAATCA–3′(reverse). PCR products were subjected to bidirectional Sanger sequencing, and chromatograms were quality-checked to remove low-quality ends and ambiguous bases. Final sequences were formatted in FASTA and compared against NCBI reference databases, with ≥98–99% similarity confirming species-level identification. The species origin of the fluid sample was confirmed, and its nucleotide sequence was uploaded in GenBank (Accession No. PX386700).
COI sequences of Filopaludina bengalensis and related taxa were aligned using MUSCLE in MEGA X, and phylogenetic reconstruction was performed by the Neighbor-Joining method with 1,000 bootstrap replicates. Evolutionary distances were estimated using the p-distance model, with positions containing gaps and missing data eliminated by complete deletion [18].
<italic id="italic-6d1da8b01ac99d19e954e912f3258a9f">Morphometric characteristics and proximate composition </italic>
Collected molluscs were thoroughly cleaned, measured, and weighed. Whole-body proximate composition, including moisture, ash, protein, lipid and carbohydrate, was determined using standard protocols [19, 20]. Moisture content (1 g/sample) was measured by drying at 135°C for 2 hrs, and ash content (1 g/sample) by incineration at 550 °C for 4 hrs, expressed as a percentage of dry weight. Crude protein (0.1 g/sample) was quantified using the Kjeldahl method (N × 6.25) following acid digestion, distillation, and titration. Lipids were extracted using petroleum ether and chloroform/ methanol (2:1) according to the Folch method, and measured gravimetrically. Carbohydrate content was calculated by difference:
<italic id="italic-680dda93a55da18f21dc4bddee13b05a">Cell viability study in human breast carcinoma cell lines<italic id="italic-744b8dadecaa3ffe7a4ca9589f3f6e58"/></italic>
The cytotoxicity of FBF and FBM extracts was evaluated using the MTT assay on human breast cancer cell lines MCF-7 (luminal) and MDA-MB-231 (triple-negative) [21]. Cells were seeded at 1×104 cells/ well in 96-well plates containing complete DMEM with heat-inactivated FBS and penicillin–streptomycin, and allowed to adhere for 24 h. Cells were then treated with extract concentrations ranging from 3.125–200 µg/ml for 24 and 48 hrs. Subsequently, 50 µl of MTT solution (5 mg/ml) was added and incubated for 4 h. Formazan crystals were solubilized with 150 µl DMSO, and absorbance was measured at 590 nm (620 nm reference) using a microplate reader. Untreated cells served as controls. Assays were performed in triplicate, and cell viability was calculated as:
Cell viability = (A samples – A blank) / (A control –A blank) × 100%
A sample is an average absorbance in wells containing cells treated with a defined concentration of the sample; A blank is the absorbance of the blank (DMSO), and A control is the absorbance of the untreated cells used as a negative control. Cell viability was calculated relative to the untreated control and IC50 value was calculated using non-linear regression curve (log dose vs response).
<italic id="italic-c712b5fc1301a9f19655fe76b61fc914">Cell viability studies in RAW 264.7 murine macrophage cells<italic id="italic-c17e7b3018f2dea941cbcb7bc2222e72"/></italic>
RAW264.7 murine macrophage-like cells, widely used in inflammation, immunology, and cancer research [22], were maintained in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin at 37 °C in a humidified 5% CO2 incubator. For cytotoxicity assessment, cell suspension (1 × 10⁴ cells/well in 200 μl of complete medium) was seeded in 96-well plates and allowed to adhere for 24 hrs. Thereafter, cells were treated with lyophilized FBF and FBM extracts dissolved in PBS at various concentrations (12.5–400 µg/ml) and further incubated for 48 hrs under the same culture conditions. Subsequently, 20 µl of MTT solution (5 mg/ml in sterile PBS) was added and incubated for 3 h. The medium was then carefully removed, and the formazan crystals, formed by viable cells were solubilized in 100 µl DMSO per well, and absorbance was recorded at 595 nm using a microplate reader.
Nitrite production in RAW264.7 culture supernatants was measured using the Griess reagent [23]. Cells (1×106 cells/ml) seeded overnight were treated with Filopaludina bengalensis extracts (12.5–400 µg/ml) and incubated for 48 hrs at 37 °C. Post-incubation, 100 µl of cell-free supernatant was mixed with 100 µl of Griess reagent and incubated in the dark for 15 min. Absorbance was recorded at 550 nm, with sodium nitrite (1–200 µM) as the standard. Nitrite levels were expressed in micromoles.
Reactive oxygen species (ROS) production in RAW264.7 cells was evaluated using the fluorescent probe H2DCFDA [23]. Cells (2 × 105/well) were seeded in 96-well black-wall plates overnight and treated with FBF and FBM at 25, 50 and 100 µg/ml for 24 hrs. Cells were washed with PBS, incubated with 1 mg/ml H2DCFDA for 30 min at 37 °C, and intracellular ROS-induced fluorescence was measured using a microplate reader (excitation 480 nm, emission 530 nm).
<italic id="italic-f91e37f91d21069a1adcee5f7168d417">Nitric oxide assay with Lipopolisaccharide (LPS) induction in RAW264.7 cell line<italic id="italic-c02c68454a1091a3d6467e379e6d588d"/></italic>
Nitric oxide (NO) production in RAW264.7 cells is increased when cells are exposed to lipopolysaccharide (LPS), a commonly used marker of inflammation [24]. RAW264.7 cells (1 × 105/well) were seeded in 96-well plates and allowed to adhere for 24 hrs. Cells were then sensitized with 1 µg/ml LPS and treated with FBF and FBM extracts at 12.5–200 µg/ml for 24 hrs at 37 °C in a humidified 5% CO2 atmosphere. Nitrite accumulation in the culture supernatant, reflecting nitric oxide production, was quantified using Griess reagent, with absorbance measured at 570 nm.
Percentage inhibition= (A-B) / (A-C) ×100
[A= absorbance of LPS+cell, B= absorbance of LPS+cell+sample, C= absorbance of only cell]. IC50 value was calculated using non-linear regression curve (log dose vs response).
GraphPad Prism 8.0.1 (GraphPad Software, La Jolla, CA, USA) was used for statistical analyses along with SPSS software. Data were presented as mean ± standard error of mean (SEM). Statistical significance was determined using one-way ANOVA, followed by Tukey’s post-hoc test for multiple comparisons.
DNA barcoding of the molluscan extrapallial fluid and mass sample, targeting the mitochondrial marker gene cytochrome c oxidase subunit 1 (COI), revealed the highest sequence similarity to Filopaludina bengalensis (family Viviparidae). BLAST analysis demonstrated 100% sequence identity with F. bengalensis (Accession No. PV174435), with all 642 base pairs of the sample sequence perfectly matching the reference. The species origin of the fluid sample was thus explicitly confirmed, and the corresponding nucleotide sequence has been deposited in the NCBI GenBank (Accession No. PX386700) for public access [25].
The Neighbour-Joining phylogeny based on COI sequences provides strong evolutionary support for the identification of the sample as Filopaludina bengalensis. In the tree (Figure 1), the present sequence clusters tightly with multiple authenticated F. bengalensis accessions, including isolates from different geographical regions, forming a high-bootstrap monophyletic clade with negligible intraspecific divergence.
This clustering pattern indicates strong genetic coherence within the species. In contrast, the F. bengalensis clade is clearly and consistently separated from other viviparid genera represented in the analysis. Genera such as Mekongia, Notopala, Trochotaia, Angulyagra, and Larina appear as distinct, well-supported evolutionary lineages, each forming its own independent clade without any overlapping or intermediate branching with F. bengalensis. The long branch lengths and high bootstrap values supporting these genera highlight the deep evolutionary divergence between them and Filopaludina. This clear phylogenetic separation confirms that the sample belongs to F. bengalensis, emphasizing the discriminatory power of the COI marker in resolving species boundaries within Viviparidae and ruling out the possibility of cross-genus misidentification.
The average length of the gastropod Filopaludina bengalensis Lamarck (n=50), including the outer shell, was estimated as 3.02 ± 0.15 cm ranging from 2 to 4 cm (Figure 2), with an average weight (with shell) of 5.57 ± 0.31 g (ranging from 4 to 7 g). The volume of extrapallial fluid aspirated from each mollusca varied with size, ranging from 0.5 to 1.0 ml.
Anatomical contributions to total molluscan mass were assessed from five randomly selected specimens (n= 5). The foot, representing the edible portion, averaged 1.03 ± 0.08 g, the remaining body 0.79 ± 0.18 g, and the shell 2.57 ± 0.12 g, with the remainder attributed to extrapallial fluid, located in the extrapallial space between the shell and the body part of the mollusca. Overall, the body accounted for the largest proportion of total mass, followed by the shell and foot.
Proximate analysis of F. bengalensis flesh as demonstrated in Table 1 emphasizing the high moisture (68.87%), substantial protein (50.44%), moderate carbohydrates (33.78%), and low lipids (4.33%), reflecting a nutrient-dense profile in the molluscan flesh (mass) with minimal fat content.
Moisture content (%)
Ash (%)
Total protein content (%)
Total lipid content (%)
Total carbohydrate content (%)
68.87 ± 1.78
11.45 ± 0.54
50.44 ± 1.26
4.33 ± 0.41
33.78 ± 1.12
Moisture is reported as % wet weight (WW), however the other proximate composition of F. bengalensis mass expressed on dry weight (DW) basis. Data represent mean ± SEM values based on three independent measurements (n = 3) conducted on the molluscan species.
The ash value indicating the remarkable amount of mineral content.
The effect of molluscan mass (FBM) and fluid (FBF) extracted from F. bengalensis was evaluated on human breast cancer cell lines, as illustrated in Figure 3.
Both F. bengalensis extracts exhibited dose and time-dependent cytotoxicity against breast cancer cell lines, with the FBF consistently more potent than FBM. In MCF-7 cells, viability at 200 µg/ml decreased from 35.8% (FBM) and 24.1% (FBF) at 24 hrs (p<0.0001) to 31.3% and 15.5% at 48 hrs (p<0.0001), corresponding to IC50 values of 70.3 ± 2.7 µg/ml (FBM, 24 hrs) compared to 19 ± 1.5 µg/ml (FBF) and 37.3 ± 1.5 µg/ml (FBM, 48 hrs) contrasted with 14 ± 1.8 µg/ml (FBF). In MDA-MB-231 cells, viability at 200 µg/ml was 41.7% (FBM) and 28.4% (FBF) at 24 hrs (p<0.0001), declining to 22.1% and 15.5% at 48 h (p<0.0001), with IC50 values of 142 ± 3.5 µg/ml (FBM, 24 hrs) compared to 49 ± 1.6 µg/ml (FBF) and 11.5 ± 2.8 µg/ml (FBM, 48 hrs) contrasted with 9.2 ± 0.5 µg/ ml (FBF). These results highlight the superior cytotoxic efficacy of the fluid extract as a potential anticancer agent.
<italic id="italic-21">Cell viability studies in RAW264.7 cells<italic id="italic-22"/></italic>
Cell viability assays in RAW264.7 cells are crucial for assessing the safety and non-toxicity of a compound on immune cells. The cytotoxicity of the F. bengalensis fluid extract was evaluated using a cell viability assay, with untreated cells serving as the control.
The cytotoxic effects of both FBM and FBF on RAW 264.7 cells were evaluated using a viability assay (Figure 4), with untreated cells as the control group. At 12.5 µg/ml, treatment with the extracts caused a slight reduction in cell viability, whereas a mild increase was observed at 25 and 50 µg/ml, however, the changes were not statistically significant.
Beyond 50 µg/ml, a concentration-dependent decline in viability was evident, with maximum cytotoxicity recorded at 400 µg/ml for both extracts (p<0.01). Overall, the minimal alterations in macrophage viability at lower concentrations highlight a favorable safety profile of the extracts, while higher doses (≥100 µg/ml) exhibited a clear dose-dependent cytotoxic response. Notably, the molluscan mass demonstrated comparatively lower toxicity than the fluid extract, aligning with the edible nature of the molluscan footpad.
<italic id="italic-53cb7346cc56783d87024fbced96c6d8">Nitrite accumulation and reactive oxygen species (ROS) generation<italic id="italic-54506cac662debabba2aea22106fee93"/></italic>
Nitrite accumulation, serving as an indirect indicator of nitric oxide (NO) production, was measured in unstimulated RAW264.7 cells following treatment with different concentrations of the extract (Figure 5A).
The untreated control cells exhibited basal nitrite levels, while treatment with both FBM and FBF at varying concentrations resulted in minimal or no changes. Negligible NO production in unstimulated macrophages indicates that the extracts do not provoke macrophage activation or NO-mediated inflammatory signalling. However, at 400 μg/ml, the fluid extract induced a significant increase in nitrite production (p < 0.0001), consistent with its cytotoxic potential at this concentration as observed previously. Overall, these findings indicate that the extracts are safe up to 200 μg/ml, as they do not elicit adverse immunological effects. Similarly, the reactive oxygen species (ROS) assay (Figure 5B) revealed no significant changes in macrophage cells following treatment with either FBM or FBF, further confirming their non-toxic nature and lack of oxidative stress induction on the immune system.
In this study, the effects of molluscan mass and fluid extracts on the inhibition of NO production were assessed in LPS-stimulated RAW264.7 cells.
RAW264.7 macrophages were stimulated with LPS to establish an inflammatory model, characterized by enhanced nitrite accumulation as an indicator of inducible nitric oxide synthase (iNOS) activity. Treatment with graded concentrations (25–400 μg/ml) of FBM and FBF resulted in a marked, concentration-dependent reduction of nitrite levels (p<0.0001) in LPS-challenged cells (Figure 6).
The inhibitory potency was reflected by IC50 values of 77.52 ± 0.53 μg/ml for FBM and 49.56 ± 1.16 μg/ml for FBF, demonstrating higher efficacy of FBF as significant anti-inflammatory potential.
Discussion
Marine and freshwater molluscs, particularly Cephalopoda, Bivalvia, and Gastropoda, are valued for their biodiversity, nutritional content, and bioactive properties, making them important as food and nutraceutical resource [3]. Snail meat, commonly consumed in Asia and parts of Europe, is rich in protein (up to 21% dry matter), essential amino acids, unsaturated fatty acids (>45% of total fat), and minerals such as calcium and magnesium. Both snail meat and mucus offer bioactive compounds, supporting their potential as health-promoting functional foods [26]. Marine organisms have gained attention for their immunomodulatory, anti-inflammatory, anticancer, antibacterial, and antiviral activities [27]. Notable examples include drugs derived from molluscs and symbiotic marine cyanobacteria, such as Adcetris®, Polivy™, and Blenrep™, and nutraceuticals like Lyprinol® and Biolane™ from the New Zealand green-lipped mussel (Perna canaliculus) [28]. Mucus from Helix aspersa contains glycosaminoglycans, mucopolysaccharides, antioxidants, and anti-inflammatory compounds, supporting its biomedical use in reducing colon inflammation [29, 30]. Various snail-derived extracts and hemocyanins have demonstrated anticancer activity against multiple human cancer cell lines, including breast, bladder, ovarian, prostate, leukemia, glioma, and colorectal cancers [31], attributed to bioactive proteins, peptides, minerals (Cu, Ca, Zn, Se), and fatty acids such as eicosapentaenoic acid (EPA), α-linolenic, linoleic, and γ-linolenic acids [32]. These findings highlight the potential of mollusc bioactives in reducing cancer cell viability, yet the biomedical applications of freshwater molluscs in inflammation, immunomodulation, and cancer remain underexplored.
Freshwater snails, including Filopaludina bengalensis, are nutrient-dense and traditionally consumed as functional food sources [27]. The proximate analysis revealed F. bengalensis flesh with high moisture (68.87%), protein (50.44%), moderate carbohydrates (33.78%), low lipids (4.33%), and notable mineral content. These findings are consistent with reports on Northeast Indian freshwater molluscs (Cipangopaludina sp., Brotia costula, F. bengalensis), which contain 22.8–26.8% crude protein, 2.7–3.8% fat, and polyunsaturated fatty acids up to 1.95% [33]. The present study emphasizes the significance of mitochondrial COI barcoding as a reliable tool for species authentication in freshwater molluscs. The unambiguous identification of Filopaludina bengalensis with 100% sequence identity ensures the robustness of COI for resolving species boundaries, even among closely related viviparid taxa. Furthermore, the discriminatory power of this taxonomic marker is evident from the clear phylogenetic separation of F. bengalensis from related genera such as Mekongia, Notopala, Trochotaia, and Angulyagra. These findings thus provide a valuable reference for future ecological and evolutionary investigations in freshwater molluscs.
Secretion extracts of Bellamya bengalensis previously exhibited selective cytotoxicity against HepG2 and Huh-7 cells (IC50 = 12.88 µg/ml and 22.99 µg/ml respectively) [15] and myeloid leukemia cells U937, K562, HL-60 (IC50= 22.21, 10.3, 12.79 μg/ml respectively), while sparing RAW264.7 macrophages and inducing NO production. Similarly, F. bengalensis fluid and mass extracts displayed dose- and time-dependent cytotoxicity against MCF-7 and MDA-MB-231 breast cancer cells, and minimal macrophage toxicity with stable NO and ROS levels, confirming safe immunomodulatory effects. In both the breast carcinoma cell lines, the F. bengalensis fluid extract exhibited substantially greater antiproliferative potency than the mass, underscoring a fundamental chemical and biological distinction between the two fractions. These findings align with previous reports showing that molluscan secretions can induce NO via the NF-κB pathway [16] particularly when combined with rIFN-γ, highlighting a potential mechanism for immunomodulatory activity. Both extracts revealed anti-inflammatory activity by inhibiting LPS-induced nitrite production in macrophages, reflecting iNOS inhibition with fluid extract (IC50 = 49.56 µg/ml) and mass extract (IC50 = 77.52 µg/ml), corroborating previous reports of Bellamya bengalensis extrapallial fluid suppressing prostaglandin and protease-mediated inflammation [14]. In the anti-inflammatory study also the better potency of the molluscan fluid suggests that it comprises of a higher concentration or bioavailability of the significant biomolecules. While the mass fraction aligned with previous descriptions of molluscan tissues as nutritionally protein-rich, also containing carbohydrates and lipids, earlier studies consistently show that molluscan fluids or mucus are particularly enriched in proteins, notably bioactive peptides [34]. Numerous anticancer and antimicrobial peptides have been isolated from marine molluscs [35, 36], notably the superior efficacy of F. bengalensis fluid extract likely reflects a peptide-rich profile. These observations strongly support the need for bioassay-guided fractionation, purification, and structural characterization to isolate the active peptide constituents, mediating the observed anticancer effects.
Although mollusc-derived bioactive compounds are known for their therapeutic and anti-inflammatory properties, research on freshwater mollusca F. bengalensis remains scarce. The present study exhibited the potential efficacy of the molluscan mass and fluid extract with highly selective cytotoxicity toward breast cancer cells while sparing immune macrophages. This selective toxicity is particularly significant in the context of current anticancer drugs, many of which are limited by severe off-target effects, nonselective cell damage, and immunosuppression. In contrast, the extract not only avoids activating immune cells but also suppresses LPS-induced nitric oxide production, suggesting a complementary immunomodulatory benefit relevant to emerging cancer–immune therapeutic strategies.
Overall, these findings position Filopaludina bengalensis as a promising source of biomolecules capable of aligning with modern targeted therapy paradigms by delivering tumor-specific cytotoxicity alongside supportive immune regulation. Future studies should focus on identifying and isolating the bioactive compounds and elucidating molecular mechanisms to facilitate drug development in oncotherapeutics.
In conclusion, marine and freshwater molluscs, represent a rich source of nutrients and bioactive molecules with considerable potential in functional foods and biomedical applications. The freshwater species Filopaludina bengalensis, the widespread freshwater mollusca are protein and mineral rich, and their identity can be reliably confirmed through DNA barcoding. The molluscan mass and fluid exhibit selective cytotoxicity against breast cancer cell lines (MCF-7 and MDA-MB-231) while preserving macrophage viability, coupled with pronounced anti-inflammatory activity through inhibition of LPS-induced nitrite production. These findings highlight the dual anticancer and immunomodulatory potential of F. bengalensis extracts, supporting their safe use in health-promoting interventions. Future work should focus on isolating specific bioactive compounds and explicating their molecular mechanisms, which could facilitate the development of targeted therapeutics and nutraceuticals derived from freshwater molluscs.
Acknowledgements
The authors sincerely thank Dr. Tamal Mondal, Scientist-D & Officer-in-Charge, Mollusca Section, Zoological Survey of India, Kolkata, for authenticating the samples, and InBOL Healthcare Pvt. Ltd., Kolkata, India, for their support in DNA barcoding analysis. Special thanks are extended to Dr. Swati Biswas, Professor, Department of Pharmacy, Birla Institute of Technology & Science-Pilani, Hyderabad Campus, India and team for their assistance in conducting the anticancer study on the breast cancer cell line.
Author Contributions Statement
S.M.- Conceptualization, Methodology, Experimental Investigation, Original Manuscript Preparation. S.J.-Sample Collection, Methodology, Experimental Investigation. S.M.- Experimental Investigation, Data Collection, Validation. B.S.- Experimental Investigation, Data Collection. R.C.- Experimental Investigation, Data Collection. S.M.- Experimental Investigation, Data Validation. J.J.J. - Supervision, Project Administration, Formal Data Interpretation. R.I.- Statistical Analysis, Software Analysis. M.R.- Hypothesis Development, Project Execution, Supervision, Review & Editing Manuscript. All authors reviewed the manuscript.
Conflict of Interest
The authors declare no conflict of interests.
Funding declaration
This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Only the sample authentication by DNA barcoding study was supported by the Institutional seed-funding support [RFMO/SF/JISU/24-25/008] of the corresponding author.
Clinical Trial Number
Not Applicable
Data Availability Statement
The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.
Correspondence and requests for materials should be addressed to M.R.
References20510172022202210.1155/2022/2051017ChandraSSaklaniSKumarPKimBCoutinho HDMBioMed Research InternationalNutraceuticals: Pharmacologically Active Potent Dietary Supplements11061177-1194174201710.1111/bph.13779AndrewRIzzo AABritish Journal of PharmacologyPrinciples of pharmacological research of nutraceuticals11109637137202010.1016/j.foodres.2020.109637ChakrabortyKJoyMFood Research InternationalHigh-value compounds from the molluscs of marine and estuarine ecosystems as prospective functional food ingredients: An overview0110241-4785201910.1093/mollus/eyy056Gilbertson CRRundell RJNiverRJournal of Molluscan StudiesDetermining diet and establishing a captive population of a rare endemic detritivore, the endangered Novisuccinea chittenangoensis (Pilsbry, 1908) (Pulmonata: Succineidae)2838201610.4103/0975-7406.171700MalveHJournal of Pharmacy And Bioallied SciencesExploring the ocean for new drug developments: Marine pharmacology1123913201710.1186/s13002-017-0167-6Borah MPPrasad SBJournal of Ethnobiology and EthnomedicineEthnozoological study of animals based medicine used by traditional healers and indigenous inhabitants in the adjoining areas of Gibbon Wildlife Sanctuary, Assam, India1011-43200910.1080/09735070.2009.11886329Prabhakar AKRoyS.P.Studies on Ethno-MedicineEthno-medicinal Uses of Some Shell Fishes by People of Kosi River Basin of North-Bihar, India15101-62012201210.5402/2012/219656SathyanNPhilipRChaithanyaE. R.Anil KumarP. R.ISRN Molecular BiologyIdentification and Molecular Characterization of Molluskin, a Histone-H2A-Derived Antimicrobial Peptide from Molluscs612683-69122200810.1111/j.1472-8206.2008.00631.xSamantaS.K.Manisenthil KumarK.T.RoyAKarmakarS.LahiriSPalitG.VedasiromoniJ.R.SenT.Fundamental & Clinical PharmacologyAn insight on the neuropharmacological activity of <i>Telescopium telescopium</i> – a mollusc from the Sunderban mangrove11320-329157201410.1016/j.jep.2014.09.009BhattacharyaSChakrabortyMBoseMMukherjeeDRoychoudhuryADharPMishraRJournal of EthnopharmacologyIndian freshwater edible snail Bellamya bengalensis lipid extract prevents T cell mediated hypersensitivity and inhibits LPS induced macrophage activation31531972020BarAEuropean Journal of Pharmaceutical and Medical ResearchBellamya bengalensis: a review on its ecological importance, nutritional values and ethnomedicinal importance7072586-260157202010.1007/s13197-020-04295-8ChatterjeeRDey TKRoychoudhuryAPaulDDharPJournal of Food Science and TechnologyEnzymatically excised oligopeptides from Bellamya bengalensis shows potent antioxidative and anti-hypertensive activity31110228-232138201110.1016/j.jep.2011.09.009GomesAAlam MADattaPBhattacharyaSGomesAJournal of EthnopharmacologyHepatoprotective activity of the edible snail (Bellamia bengalensis) flesh extract in carbon tetrachloride induced hepatotoxicity in rats0608202510.9790/3008-10426166Adhikari A,BhattacharyaSSur TKBandyopadhyay SKResearchGateAnti-Inflammatory Activities of Indian Fresh Water Edible Mollusca1461152202013Besra SERayMDeySRoySDebNInternational Journal of Pharmaceutical Sciences Review and ResearchApoptogenic activity of secretion extract of Bellamya Bengalensis f. annandalei via mitochondrial mediated caspase cascade on human leukemic cell lines2326–234442013BesraAPalKBasuSBesra SEWorld Journal of Pharmaceutical ResearchAnti-tumor activities of secretion extract of Bellamya bengalensis in human hepatocellular carcinoma cell lines are mediated by caspase-dependent apoptosis and cell cycle arrest101761-77550202310.1007/s11033-022-08015-7AntilSAbraham JSSripoornaS.MauryaSDagarJMakhijaSBhagatPet alMolecular Biology ReportsDNA barcoding, an effective tool for species identification: a review19303e031952420202510.1371/journal.pone.0319524Vielma-Puente JESantos-OrdóñezECornejoXChóez-GuarandaIPacheco-CoelloRVillao-UzhoLMoreno-AlvaradoCet alPLOS ONEDNA Barcode, chemical analysis, and antioxidant activity of Psidium guineense from Ecuador505e095278202210.1016/j.heliyon.2022.e09527ManetLMbanga Baleba RMBonnyPPool Likeng JDMouafo HTMedoua GNHeliyonProximate composition, microbiological quality and presence of total aflatoxins and aflatoxin B1 in the flesh of three snails’ species (Achatina achatina, Achatina fulica and Archachatina marginata) from a selected locality of Yaoundé, Cameroon505e070887202110.1016/j.heliyon.2021.e07088MoniruzzamanMSkuSChowdhuryPTanu MBYeasmineSHossen MNMinTBai SCMahmudYHeliyonNutritional evaluation of some economically important marine and freshwater mollusc species of Bangladesh2-412113-1214201510.1007/s40204-015-0042-2Jannathul FirdhouseMLalithaPProgress in BiomaterialsApoptotic efficacy of biogenic silver nanoparticles on human breast cancer MCF-7 cell lines22071-14202510.1080/27697061.2025.2536301MandalSBiswasABakshiUPramanikMAliMMajumdarSKar MahapatraSJawed JJJournal of the American Nutrition AssociationUrsolic Acid Reduces Parasite Burden Through Th-1 Mediated Immunomodulation in Experimental Visceral Leishmaniasis04111017154202210.1016/j.foodres.2022.111017QinLChenSXieLYuQChenYShenMXieJFood Research InternationalMechanisms of RAW264.7 macrophages immunomodulation mediated by polysaccharide from mung bean skin based on RNA-seq analysis612895-90225200210.1007/BF02977011HanSSungKYimDLeeSChoKLeeCHaNKimKArchives of Pharmacal ResearchActivation of murine macrophage cell line RAW 264.7 by Korean propolisNCBI. PX386700. National Center for Biotechnology Information. 2025. https://www.ncbi.nlm.nih.gov/nuccore/PX3867001210133018202410.1016/j.jafr.2024.101330GuptaAKhanalPJournal of Agriculture and Food ResearchThe potential of snails as a source of food and feed2770642220202210.3390/md20070422MontuoriEDe PascaleDLauritanoCMarine DrugsRecent Discoveries on Marine Organism Immunomodulatory Activities01156-178210201810.1016/j.jep.2017.08.008Ahmad TBLiuLKotiwMBenkendorffKJournal of EthnopharmacologyReview of anti-inflammatory, immune-modulatory and wound healing properties of molluscs151809995825202410.3390/ijms25189958HermanAWińskaPBiałekMHerman APInternational Journal of Molecular SciencesBiological Properties of the Mucus and Eggs of Helix aspersa Müller as a Potential Cosmetic and Pharmaceutical Raw Material: A Preliminary Study21202e022961315202010.1371/journal.pone.0229613GentiliVBortolottiDBenedusiMAlognaAFantinatiAGuiottoATurrinGet alPLOS ONEHelixComplex snail mucus as a potential technology against O3 induced skin damage2870630422202410.3390/md22070304Cutolo EACampitielloRCaferriRPagliuca VFLiJAgathos SNCutoloMMarine DrugsImmunomodulatory Compounds from the Sea: From the Origins to a Modern Marine Pharmacopoeia03404106419201810.3390/ijms19041064MatusiewiczMKosieradzkaINiemiecTGrodzikMAntushevichHStrojnyBGołębiewskaMInternational Journal of Molecular SciencesIn Vitro Influence of Extracts from Snail Helix aspersa Müller on the Colon Cancer Cell Line Caco-202607455-46833202410.1080/10498850.2024.2371818BhattacharyyaBDas PPGBorkatakiSBhairaviK. SJournal of Aquatic Food Product TechnologyMolluscophagy in North East India: Assessment of Nutritive Value of Four Edible Freshwater Molluscs1124213202310.1007/s13659-023-00404-0RashadMSampòSCataldiAZaraSNatural Products and BioprospectingBiological activities of gastropods secretions: snail and slug slime1701132138614202410.3389/fmicb.2023.1321386QuBYuanJLiuXZhangSMaXLuLFrontiers in MicrobiologyAnticancer activities of natural antimicrobial peptides from animals4100-10615202410.62347/JGQA3746RafieezadehDInternational Journal of Biochemistry and Molecular BiologyExploring the seas for cancer cures: the promise of marine-derived bioactive peptide